BacPP runs files with sequences in the FASTA format. It is posssible to provide several sequences in a unique file.
Please, check if your file is as one of the formats presented below.
Example 1:
>gi|89243343|gb|DQ401103.1|Aeromonas hydrophila plasmid pRA3, complete sequence
ATGGCGCAAGCTCAGTTGTCCTTGTTCGGTCAGAACGAGGCAGAAA
CATATCACGACACAAGCGCAAGGGGCTTTTTCTCGCTCCTGGTGCAA
TGGCCAACCGGCAAACGTCAATCCTCTTTCCCTCTTGAGCAGATGCC
AACAGTCCTTAATGCTGTTGATCATCGTCTTGATACCTGGCTATCACA
GGCCGAGTTTATGCGGCCAAACAGGCGAGTCGTGAACCTCCTTCGG
ATTGGTTTGTTATTCGCTGATCTCGATACCTACAAGATGCCCTGGGCT

Example 2:

The BacPP output is organized as follows:
- The first line is the identification of the sequence (header), provided by the input file.
- The next line presents the results: (A) number of the first nucleotide analyzed; (B) number of the last nucleotide analyzed; (C) the probability(ies) of the sequence be recognized by the chosen sigma(s). 
- All fields are separated by tab character.

BacPP is a tool designed to analyse sequences with 80 nucleotides as maximum length. If the input sequence is larger than 80 nucleotides, it will be sliced in subsequences. The slice is carried out in sliding overlapping windows with one nucleotide step.
The numbers of the initial and final nucleotides, of each subsequence, are presented as first information in line result lines.

BacPP is a tool free of charge. The analysis can be carried out in the restricted area, which is available after the login.
Please make a free and short registration. The user registration is free of charge and it is required for statistical and database usage registration purposes. After the login, the BacPP tab will appear in the browser.

It is possible to make a user registration in the link "Not registred yet"?

If you do not remember your password, contact us. We will provide a new one for you.

A graphical view of the architecture of BacPP web site.